Beritadan foto terbaru pura pura lupa - Chord Gitar Lagu Pura Pura Lupa - Mahen: Jangan Datang Lagi Cinta, Bagaimana Aku Bisa Lupa. Selasa, 21 Juni 2022; Cari. Network. Tribunnews.com;
Sheis known for singing and playing the ukulele. Her 2018 self-released EP, plum blossom, recorded on her laptop in her parents' guest bedroom, has been streamed over 100 million times. In 2019, she played sold out tours and her debut album the masquerade was released in September.
Chord Chord Ukulele; Chord Gitar; Lirik Lagu; Notes. Not Pianika; Pura Pura Lupa - Mahen 5 5 5 6 7 1' 1' 3 Pernah aku jatuh hati 1 6 6 6 5 4 3 5 Padamu sepenuh hati 1 6 6 6 5 4 3 5 Hidup pun akan kuberi 1 4 4 4 3 4 5 2 Apapun kan ku lalui 1 5 5 5 6 7 1' 1' 3 Tapi tak pernah ku bermimpi
CHORDSUSED (F, G, Am, C, G#, D#, C#, F#, Fm, Bb, Cm, B) ~ no capo verse F G Am Berat bebanku F G Am meninggalkanmu F G Am G C G F Separuh nafas jiwaku sirna F G Am Bukan salahmu F G Am Apa daya ku F G Am G C mungkin benar cinta sejati G F G F Tak berpihak pada kita chorus F G C Kasihku G Am Sampai di sini kisah kita G F Jangan tangisi keadaannya C F G Bukan karna kita berbeda F G C Dengarkan
Berikut adalah Chord Ukulele Pura Pura Lupa - Mahen yang kamu cari-cari, lagu ini dapat kamu mainkan dengan mudah, dan silahkan ganti chord sesuai dengan nada vokal kamu ya teman-teman. Untuk stel-an GCEA silahkan Transpose ke F dan stel-an standar Transpose ke C. (Intro) G D Em D C Bm Em F D G D Em pernah aku jatuh hati C Bm padamu
96eHP9. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCCCCCCGCAmCCCCFCGCCCFCCCAmCCCFCCCGCCCCCGCCCAmCFCCCGCCCFCCAmCCCCDmCCCGCCCCCCCCCCCGCCCGCCCCCFCGCCCCCCCCFGCCCCCGCCCCCACFGCCCFCCGCCCCFCCGCCCCFCCAmGCCCCCCEmCGCBCCCCCCCCFCCDGCCCCCCCCCCGCCFCEmCCCGCCCCDmFmGCFCGCCCCCCCFCGCCFCCGCCCCCAmCFGCCCCCCCEmCCFCCCGCCCCFCCGCCCCCCCGCCCCCCCGCCCCGFCGCCCCCCCCCCACCGCCCCFmGCCCCACCGCCCCDCCGCCCCACFmCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratioCBmDGEmCmFmFACFDmEBGmGAmFm arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNCNNBmNNDNNNGNNNDNNNNNNNNNBmNNNNNGNNNNNNDNNNGNNNNDNNNNEmNNNNNDNNNNNNNCmNDNNNNNGNNNNFmNNNNNGNNNNFmNNBmNEmNNNNNBmNNNNNNNNNNFNNNANNNNNNNNEmNNNNNNNANNNNDNNNNGNNNDNNNNNNNANNNNBmNNNNANNNNGNNNNNDNNNNCNNNNANNNNNDNNNNNANNNBmNNNNNANNNNGNNNNDNNNNNEmNNNNANNNNDNNNNNNNNNNGNNNNNFmNNNNFNNNNGNNNNNNNNNNDmNNNNNNNNNNANFNNBmNNNNFNNNNNNNANNNENNNEmNNNNNANNNNDNNNNNBmNDNNNNNNNNNANNNBmNNNNANNNNNNGNNNBmNNNNEmNNNNANNNNNDNNNNNANNNNNBmNNNANNNNGNNNNNDNNNNEmNNNNANNNNNDNNNNANNBNENNNNNNBNNCmNNNNNBNNNNNANNNNENNNNNFmNNNNBNNNNENNNNNNNNNNNCmNNNNNNENNNNANNGmNNCmNANNNNNBNNNNENNNNNNNNNNANNNNENNNNNANNNNENNNNFmNNNNBNNNNNENNNNNNANNNNENNNNNNNNNNNNNNNNNCNNNNNNGNNNNNNAmNNNNNNNNNFmNNNNNNCNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
pura pura lupa chord ukulele